Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250400

Morpholino Name: spred2 MO1
Synonyms: Sprd2 ATG
mRNA Target: spred2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCCTCGCTCATTTTGTCCCTGCTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' TGAGCAGGGACAAAATGAGCGAGGA 3' ||||||||||||||||||||||||| 3' ACTCGTCCCTGTTTTACTCGCTCCT 5' 5' TGAGCAGGAACAAAATGAGCGAGGA 3' |||||||| |||||||||||||||| 3' ACTCGTCCCTGTTTTACTCGCTCCT 5' 5' TGAGAAGAGACAAAATGAGCGAGGA 3' |||| || ||||||||||||||||| 3' ACTCGTCCCTGTTTTACTCGCTCCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:29795175..29795199 24/25 Antisense target spred2.L
chr5S:2056096..2056120 23/25 Antisense target spred2.S
chr9_10L:25118144..25118168 21/25 unknown
tropicalis 10.0 Chr5:31852617..31852641 25/25 Antisense target spred2
Publications
First: FGF signal interpretation is directed by Sprouty and Spred proteins during mesoderm formation., Dev Cell 2005        
Most recent:
View All Papers