Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250401

Morpholino Name: spred2 MO2
Synonyms: Sprd2 e2i2
mRNA Target: spred2

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCCTTACCAGTTTGTCATTCAGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genomic

MO
5' GACTGAATGACAAACTGGTAAGGAA 3' ||||||||||||||||||||||||| 3' CTGACTTACTGTTTGACCATTCCTT 5' 5' GACTCAATGACAAACTGGTAAGGGA 3' |||| |||||||||||||||||| | 3' CTGACTTACTGTTTGACCATTCCTT 5' 5' GATTGAATGACAAACTGGTAAGGAA 3' || |||||||||||||||||||||| 3' CTGACTTACTGTTTGACCATTCCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:2021865..2021889 24/25 Antisense target spred2.S
chr5L:29833500..29833524 23/25 Antisense target spred2.L
chr5L:16412412..16412436 23/25 Sense off-target tp53bp2.L
chr5L:101533582..101533606 21/25 Sense off-target zan.L
chr1L:61725564..61725588 21/25 Sense off-target ap1ar.L
chr5S:86475392..86475416 21/25 unknown
chr7L:110699175..110699199 21/25 unknown
chr7L:119256163..119256187 21/25 unknown
tropicalis 10.0 Chr5:31885778..31885802 25/25 Antisense target spred2
Publications
First: FGF signal interpretation is directed by Sprouty and Spred proteins during mesoderm formation., Dev Cell 2005        
Most recent:
View All Papers