Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250402

Morpholino Name: spry1 MO1
Synonyms: Spry1 i1e2
mRNA Target: spry1

Morpholino Type: uncategorized morpholino
Sequence:
5' CATCTGAAAACCTGCCGATCAAAAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 21/25 22/25
genomic

MO
5' GTTTTGATCGGCAGGTTTTCAGATG 3' ||||||||||||||||||||||||| 3' CAAAACTAGCCGTCCAAAAGTCTAC 5' 5' TTTTTTGTTGGCAGGTTTTCAGATG 3' |||| | |||||||||||||||| 3' CAAAACTAGCCGTCCAAAAGTCTAC 5' 5' GATTCGATTGGCAGGTTTTCAGATG 3' | || ||| |||||||||||||||| 3' CAAAACTAGCCGTCCAAAAGTCTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:54035895..54035919 22/25 Antisense target spry1.S
chr1L:58820443..58820467 21/25 Antisense target spry1.L
chr7S:29496376..29496400 21/25 Sense off-target Xelaev18037107m
tropicalis 10.0 Chr1:65663855..65663879 25/25 Antisense target spry1
Chr1:78305009..78305033 21/25 unknown
Publications
First: FGF signal interpretation is directed by Sprouty and Spred proteins during mesoderm formation., Dev Cell 2005        
Most recent:
View All Papers