Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250404

Morpholino Name: spry2 MO1
Synonyms: Spry2 e1i1
mRNA Target: spry2

Morpholino Type: uncategorized morpholino
Sequence:
5' GTACTTACCGTGACCTCCTCGCCCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25 21/25
genomic

MO
5' GGGGCGAGGAGGTCACGGTAAGTAC 3' ||||||||||||||||||||||||| 3' CCCCGCTCCTCCAGTGCCATTCATG 5' 5' GGGTAGAGGAGGTCACGGTAAGTAG 3' ||| ||||||||||||||||||| 3' CCCCGCTCCTCCAGTGCCATTCATG 5' 5' CGGGAGCGGACGTCACGGTAAGTAC 3' ||| | ||| |||||||||||||| 3' CCCCGCTCCTCCAGTGCCATTCATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:124643558..124643582 22/25 Antisense target spry2.L
chr2S:106932824..106932848 21/25 Antisense target spry2.S
tropicalis 10.0 Chr2:125071213..125071237 25/25 Antisense target spry2
Publications
First: FGF signal interpretation is directed by Sprouty and Spred proteins during mesoderm formation., Dev Cell 2005        
Most recent:
View All Papers