Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250405

Morpholino Name: spry2 MO2
Synonyms: Spry2 ATG, XSpry2-MO
Target mRNA: spry2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCATTTTGTACTCTCGTCTCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GATGGAGACGAGAGTACAAAATGGC 3' ||||||||||||||||||||||||| 3' CTACCTCTGCTCTCATGTTTTACCG 5' 5' GATGGAGACGAGAGTACAAAATGGC 3' ||||||||||||||||||||||||| 3' CTACCTCTGCTCTCATGTTTTACCG 5' 5' GATGGAGACGAGAGTACAAAATGGC 3' ||||||||||||||||||||||||| 3' CTACCTCTGCTCTCATGTTTTACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:124647983..124648007 25/25 Antisense target spry2.L
chr2S:106936662..106936686 25/25 Antisense target spry2.S
chr1L:6427239..6427263 21/25 Sense off-target nagk.L
chr2L:68404270..68404294 21/25 Sense off-target LOC108708158
chr3L:963904..963928 21/25 Antisense off-target sult6b1l.L
chr6L:148061975..148061999 21/25 Antisense off-target col22a1-like.2.L
chr8L:113486214..113486238 21/25 Antisense off-target dusp23.L
Scaffold103500:160..184 21/25 unknown
chr1L:3390287..3390311 21/25 unknown
chr6L:151977326..151977350 21/25 unknown
chr6L:151977516..151977540 21/25 unknown
chr7S:3079158..3079182 21/25 unknown
chr8L:90566451..90566475 21/25 unknown
tropicalis 10.0 Chr2:125076161..125076185 25/25 Antisense target spry2
Chr7:132200889..132200913 21/25 Sense off-target hspg2
Chr1:208465540..208465564 22/25 unknown
Chr1:208465616..208465640 22/25 unknown
Chr3:3590724..3590748 22/25 unknown
Chr3:96823597..96823621 21/25 unknown
Chr9:90333721..90333745 21/25 unknown
Publications
First: FGF signal interpretation is directed by Sprouty and Spred proteins during mesoderm formation., Dev Cell 2005        
Most recent: Regulation of ERK activity duration by Sprouty contributes to dorsoventral patterning., Nat Cell Biol 2009  
View All Papers