Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250408

Morpholino Name: srf MO1
Synonyms: XSRF MO1
mRNA Target: srf

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGGTTACTGGGCAGCATCCCTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' CAAGGGATGCTGCCCAGTAACCAG 3' |||||||||||||||||||||||| 3' GTTCCCTACGACGGGTCATTGGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold111824:6739928..6739951 24/24 Antisense off-target Xelaev16003073m
Scaffold12020:13476057..13476080 24/24 Antisense target srf.L
Scaffold167628:3933281..3933304 21/24 unknown
Scaffold337436:257719..257742 21/24 unknown
Scaffold24235:1352759..1352782 20/24 Antisense off-target Xelaev16032014m
Scaffold74352:2798873..2798896 20/24 Antisense off-target Xelaev16071011m
tropicalis 7.1 scaffold_7:123829995..123830018 21/24 unknown
scaffold_4:12520503..12520526 20/24 unknown
scaffold_4:12567138..12567161 20/24 unknown
scaffold_4:12607075..12607098 20/24 unknown
Publications
First: Negative regulation of Activin/Nodal signaling by SRF during Xenopus gastrulation., Development 2007                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556