Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250413

Morpholino Name: ssr3 MO1
Synonyms: TRAP-gamma, XTRAP-gamma MO, XTrap-g MO
mRNA Target: ssr3

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTTGTTGCCAGCTTTCGGAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 23/25 25/25
genomic

MO
5' ATGGCTCCGAAAGGTGGTAACAAGC 3' ||||||||||||| ||| ||||||| 3' TACCGAGGCTTTCGACCGTTGTTCG 5' 5' ATGGCTCCGAAAGGTGGTAACAAGC 3' ||||||||||||| ||| ||||||| 3' TACCGAGGCTTTCGACCGTTGTTCG 5' 5' ATGGCTCCGAAAGCTGGCAACAAGC 3' ||||||||||||||||||||||||| 3' TACCGAGGCTTTCGACCGTTGTTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold82102:1806363..1806387 25/25 Antisense target ssr3.S
Scaffold387329:1809248..1809272 23/25 Antisense target ssr3.L
Scaffold111824:1322903..1322927 21/25 Antisense off-target Xelaev16002977m
tropicalis 7.1 scaffold_5:20627181..20627205 23/25 Antisense target ssr3
Publications
First: The role of XTRAP-gamma in Xenopus pronephros development., Int J Dev Biol 2005              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556