Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250427

Morpholino Name: sulf1 MO1
Synonyms: XtSulf1, XtSulf1 AMO3, Xtsulf1-S1AMO3
mRNA Target: sulf1

Morpholino Type: uncategorized morpholino
Sequence:
5' TATAAGAAAACTCTCACCTAACTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAGTTAGGTGAGAGTTTTCTTATA 3' ||||||||||||||||||||||||| 3' CCTCAATCCACTCTCAAAAGAATAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold150977:446354..446378 23/25 Antisense off-target Xelaev16014899m
Scaffold102974:21119620..21119644 22/25 unknown
Scaffold160942:6446252..6446276 21/25 Sense off-target slc30a8.L
Scaffold23872:1977368..1977392 21/25 unknown
Scaffold272406:184678..184702 21/25 Antisense off-target Xelaev16037245m
tropicalis 7.1 scaffold_6:29789447..29789471 25/25 Antisense target sulf1
scaffold_6:67296607..67296631 22/25 unknown
scaffold_3:94622574..94622598 21/25 unknown
Publications
First: Extracellular regulation of developmental cell signaling by XtSulf1., Dev Biol 2008              
Most recent: Neural crest migration requires the activity of the extracellular sulphatases XtSulf1 and XtSulf2., Dev Biol 2010                                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556