Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250428

Morpholino Name: sulf1 MO2
Synonyms: XtSulf1, XtSulf1 AMO4, Xtsulf1- S1AMO4
mRNA Target: sulf1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTGCAACGAACCTGAAATAAATAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' TTATTTATTTCAGGTTCGTTGCAGG 3' ||||||||||||||||||||||||| 3' AATAAATAAAGTCCAAGCAACGTCC 5' 5' TTATTTATTTCAGGTTCGTTGCAGG 3' ||||||||||||||||||||||||| 3' AATAAATAAAGTCCAAGCAACGTCC 5' 5' TTATTTATTTCAGGTTCGTTGCAGG 3' ||||||||||||||||||||||||| 3' AATAAATAAAGTCCAAGCAACGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:121143611..121143635 25/25 Antisense target sulf1.L
chr6S:96894385..96894409 25/25 Antisense target sulf1.S
chr1S:165272839..165272863 21/25 unknown
tropicalis 10.0 Chr6:119952362..119952386 25/25 Antisense target sulf1
Publications
First: Extracellular regulation of developmental cell signaling by XtSulf1., Dev Biol 2008              
Most recent: Neural crest migration requires the activity of the extracellular sulphatases XtSulf1 and XtSulf2., Dev Biol 2010                                
View All Papers