Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250429

Morpholino Name: sulf1 MO3
Synonyms: Xt sulf2 S1AMO
mRNA Target: sulf1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATAAGAAAACTCTCACCTAACTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:138765394..138765417 24/24 Antisense off-target xbp1.S
chr1L:167319406..167319429 24/24 Antisense off-target xbp1.L
chr2L:86240333..86240356 21/24 Sense off-target LOC108707510 [provisional:csmd2]
chr7L:113590140..113590163 21/24 Sense off-target ppfia3.L
chr3L:6486553..6486576 20/24 Sense off-target LOC108710765 [provisional:ebf1]
chr4S:100155088..100155111 20/24 Sense off-target mapkapk3.S
chr6L:100002741..100002764 20/24 unknown
chr6S:57718411..57718434 20/24 unknown
chr8L:71481021..71481044 20/24 unknown
chr8L:85338928..85338951 20/24 unknown
tropicalis 10.0 Chr1:166351551..166351574 24/24 Antisense off-target xbp1
Chr10:28266496..28266519 20/24 Antisense off-target slc38a10
Chr2:136371902..136371925 20/24 Antisense off-target kmt2d
Chr2:136371992..136372015 20/24 Antisense off-target kmt2d
Chr2:53399634..53399657 20/24 unknown
Chr2:71955007..71955030 20/24 unknown
Publications
First: Neural crest migration requires the activity of the extracellular sulphatases XtSulf1 and XtSulf2., Dev Biol 2010                                
Most recent: Sulf1 influences the Shh morphogen gradient during the dorsal ventral patterning of the neural tube in Xenopus tropicalis., Dev Biol 2014                    
View All Papers