Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250430

Morpholino Name: sulf2 MO1
Synonyms: Xt sulf2 S2 AMO, Xtsulf2
mRNA Target: sulf2

Morpholino Type: uncategorized morpholino
Sequence:
5' GAACAATATTCGCTGCTGCCCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGGGGCAGCAGCGAATATTGTTC 3' ||||||||||||||||||||||||| 3' CTACCCCGTCGTCGCTTATAACAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13471:3950873..3950897 22/25 unknown
Scaffold3467:5314663..5314687 21/25 Antisense off-target Xelaev16045614m
tropicalis 7.1 scaffold_10:12080073..12080097 25/25 Antisense target sulf2
Publications
First: Neural crest migration requires the activity of the extracellular sulphatases XtSulf1 and XtSulf2., Dev Biol 2010                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556