Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250438

Morpholino Name: szl MO1
Synonyms: MOSZL, Sizzled MO, Szl MO, szlMO
mRNA Target: szl

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGGAGCAGGAAGACTCCGGTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CATGACTGGAGTCTTCCTGCTCCTC 3' |||||| |||||||||||||||||| 3' GTACTGGCCTCAGAAGGACGAGGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold152894:424871..424895 24/25 Antisense off-target Xelaev16015288m
Scaffold26505:3178288..3178312 24/25 Antisense off-target Xelaev16035589m
Scaffold14557:5403943..5403967 22/25 Sense off-target Xelaev16013310m
Scaffold150977:859075..859099 22/25 Sense off-target Xelaev16014906m
Scaffold45343:30137..30161 22/25 unknown
tropicalis 7.1 scaffold_3:100185119..100185143 24/25 Antisense target szl
Publications
First: The secreted Frizzled-related protein Sizzled functions as a negative feedback regulator of extreme ventral mesoderm., Development 2003          
Most recent: Syndecan4 coordinates Wnt/JNK and BMP signaling to regulate foregut progenitor development., Dev Biol 2016                                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556