Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250438

Morpholino Name: szl MO1
Synonyms: MOSZL, Sizzled MO, Szl MO, szlMO
Target mRNA: szl

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGGAGCAGGAAGACTCCGGTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genomic

MO
5' CATGACTGGAGTCTTCCTGCTCCTC 3' |||||| |||||||||||||||||| 3' GTACTGGCCTCAGAAGGACGAGGAG 5' 5' CATGACTGGAGTCTTCCTGCTCCTC 3' |||||| |||||||||||||||||| 3' GTACTGGCCTCAGAAGGACGAGGAG 5' 5' CATGTCCGGAGTCTTCCTGCTCCTC 3' |||| |||||||||||||||||||| 3' GTACTGGCCTCAGAAGGACGAGGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:62873250..62873274 24/25 Antisense target szl.L
chr3S:75691020..75691044 24/25 Antisense target szl.S
chr9_10L:9573478..9573502 22/25 Sense off-target prex1.L
chr9_10L:9573478..9573502 22/25 Antisense off-target sulf2.L
chr9_10S:8849949..8849973 22/25 Sense off-target prex1.S
chr6L:120730187..120730211 22/25 Sense off-target LOC108719287 [provisional:prex2]
tropicalis 10.0 Chr3:71700011..71700035 24/25 Antisense target szl
Publications
First: The secreted Frizzled-related protein Sizzled functions as a negative feedback regulator of extreme ventral mesoderm., Development 2003          
Most recent: Syndecan4 coordinates Wnt/JNK and BMP signaling to regulate foregut progenitor development., Dev Biol 2016                                    
View All Papers