Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250439

Morpholino Name: szl MO2
Synonyms:
mRNA Target: szl

Morpholino Type: uncategorized morpholino
Sequence:
5' AGAGGAGCAGGAAGACTCCGGACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATGACTGGAGTCTTCCTGCTCCTCT 3' ||| | ||||||||||||||||||| 3' TACAGGCCTCAGAAGGACGAGGAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold152894:424870..424894 25/25 Antisense off-target Xelaev16015288m
Scaffold26505:3178289..3178313 23/25 Antisense off-target Xelaev16035589m
Scaffold150977:859076..859100 21/25 Sense off-target Xelaev16014906m
Scaffold73936:179816..179840 21/25 Antisense off-target Xelaev16070770m
Scaffold93416:6401400..6401424 21/25 unknown
tropicalis 7.1 scaffold_3:100185120..100185144 23/25 Antisense target szl
scaffold_7:64693961..64693985 22/25 unknown
scaffold_3:32876610..32876634 21/25 Sense off-target dennd4a
scaffold_5:80204139..80204163 21/25 Sense off-target igf2r
Publications
First: sizzled function and secreted factor network dynamics., Biol Open 2012              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556