Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250440

Morpholino Name: t MO1
Synonyms: xbra, xbra MO
mRNA Target: t

Morpholino Type:
Sequence:
5' GCGCAGCTCTCGGTCGCACTCATTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GAATGAGTGCGACCGAGAGCTGCGC 3' |||||||||||||||||||||||| 3' ATTACTCACGCTGGCTCTCGACGCG 5' 5' TAATGAGTGCGACCGAGAGCTGCGC 3' ||||||||||||||||||||||||| 3' ATTACTCACGCTGGCTCTCGACGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14467:588823-588847 25/25 Antisense target t.S
Scaffold312114:437939-437963 24/25 Antisense target t.L
Publications
First: Snail2 controls mesodermal BMP/Wnt induction of neural crest. [Development 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556