Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250440

Morpholino Name: tbxt MO1
Synonyms: xbra, xbra MO
mRNA Target: tbxt

Morpholino Type: uncategorized morpholino
Sequence:
5' GCGCAGCTCTCGGTCGCACTCATTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GAATGAGTGCGACCGAGAGCTGCGC 3' |||||||||||||||||||||||| 3' ATTACTCACGCTGGCTCTCGACGCG 5' 5' TAATGAGTGCGACCGAGAGCTGCGC 3' ||||||||||||||||||||||||| 3' ATTACTCACGCTGGCTCTCGACGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:46679841..46679865 25/25 Antisense target tbxt.S
chr5L:56213079..56213103 24/25 Antisense target tbxt.L
Publications
First: Snail2 controls mesodermal BMP/Wnt induction of neural crest., Development 2011                    
Most recent:
View All Papers