Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250441

Morpholino Name: t2 MO1
Synonyms: xbra
mRNA Target: t2

Morpholino Type:
Sequence:
5' CATAGTATTGATGATGTCTCCTCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold330256:55178..55202 25/25 Antisense off-target Xelaev16043830m
Scaffold20920:577890..577914 22/25 unknown
tropicalis 7.1 scaffold_6:54294271..54294295 22/25 unknown
Publications
First: Neurotrophin receptor homolog (NRH1) proteins regulate mesoderm formation and apoptosis during early Xenopus development. [Dev Biol 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556