Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250442

Morpholino Name: tacc3 MO1
Synonyms: Maskin
mRNA Target: tacc3

Morpholino Type:
Sequence:
5' CATCGTTTATGATTTGAAGGCTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGAGCCTTCAAATCATAAACGATG 3' ||||||||||||||||||||||||| 3' TACTCGGAAGTTTAGTATTTGCTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold132268:282145..282169 25/25 Antisense target tacc3.S
Scaffold3467:3301689..3301713 23/25 Antisense off-target Xelaev16045565m
Scaffold1187:11574872..11574896 21/25 unknown
tropicalis 7.1 scaffold_31:96115..96139 21/25 unknown
Publications
First: Translational control of the embryonic cell cycle. [Cell 2002]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556