Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250443

Morpholino Name: tbp MO1
Synonyms: TBP MO
mRNA Target: tbp

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCTGTTGTTTTGATCCATGTTGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genomic

MO
5' CGCAACATGGATCAAAACAACAGTA 3' | ||||||||||||||||||||| | 3' GTGTTGTACCTAGTTTTGTTGTCGT 5' 5' CACGACATGGATCAAAACAACAGCA 3' ||| ||||||||||||||||||||| 3' GTGTTGTACCTAGTTTTGTTGTCGT 5' 5' CACAACATGGATCAAAACAACAGCA 3' ||||||||||||||||||||||||| 3' GTGTTGTACCTAGTTTTGTTGTCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:41778818..41778842 25/25 Antisense target tbp.S
chr5L:50530984..50531008 24/25 Antisense target tbp.L
chr1L:42006863..42006887 22/25 unknown
Scaffold29:2413776..2413800 21/25 unknown
chr2S:14002787..14002811 21/25 unknown
chr4L:143864157..143864181 21/25 unknown
tropicalis 10.0 Chr5:50707766..50707790 23/25 Antisense target tbp
Chr1:21367987..21368011 21/25 Antisense off-target poln
Chr9:78846127..78846151 21/25 Sense off-target gtdc1
Publications
First: Concentrations of TATA box-binding protein (TBP)-type genes affect chordamesodermal gene expression., Int J Dev Biol 2008      
Most recent:
View All Papers