Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250444

Morpholino Name: tbpl1 MO1
Synonyms: TLF MO
mRNA Target: tbpl1

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCCACATCACTGTCAGCATCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGGATGCTGACAGTGATGTGGCA 3' ||||||||||||||||||||||||| 3' CTACCTACGACTGTCACTACACCGT 5' 5' GATGGATGCTGACAGTGATGTGGCA 3' ||||||||||||||||||||||||| 3' CTACCTACGACTGTCACTACACCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:71768729..71768753 25/25 Antisense target tbpl1.L
Scaffold49:1133313..1133337 24/25 Antisense off-target LOC108704788 [provisional:tbpl1]
chr2S:108724601..108724625 22/25 unknown
chr6S:82684662..82684686 22/25 Antisense off-target ppp4r1.S
chr5L:159005267..159005291 21/25 Sense off-target trim54.L
tropicalis 10.0 Chr5:71168484..71168508 25/25 Antisense target tbpl1
Publications
First: Concentrations of TATA box-binding protein (TBP)-type genes affect chordamesodermal gene expression., Int J Dev Biol 2008      
Most recent:
View All Papers