Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250445

Morpholino Name: tbpl2 MO1
Synonyms: TBP2 MO
mRNA Target: tbpl2

Morpholino Type: uncategorized morpholino
Sequence:
5' GAAGACTCTCCATCCATTTTGAGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GCCTCAAAATGGATGGAGAGTCTTC 3' |||||||||||||||||||||||| 3' GGGAGTTTTACCTACCTCTCAGAAG 5' 5' CCCTCAAAATGGATGGAGAGTCTTC 3' ||||||||||||||||||||||||| 3' GGGAGTTTTACCTACCTCTCAGAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold91950:911560..911584 25/25 Antisense target tbpl2.L
Scaffold211:263573..263597 21/25 Antisense off-target Xelaev16027312m
Scaffold340515:16..40 21/25 unknown
Scaffold43993:929..953 21/25 unknown
tropicalis 7.1 scaffold_8:83520127..83520151 24/25 Antisense target tbpl2
Publications
First: Concentrations of TATA box-binding protein (TBP)-type genes affect chordamesodermal gene expression., Int J Dev Biol 2008      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556