Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250445

Morpholino Name: tbpl2 MO1
Synonyms: TBP2 MO
mRNA Target: tbpl2

Morpholino Type: uncategorized morpholino
Sequence:
5' GAAGACTCTCCATCCATTTTGAGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GCCTCAAAATGGATGGAGAGTCTTC 3' |||||||||||||||||||||||| 3' GGGAGTTTTACCTACCTCTCAGAAG 5' 5' CCCTCAAAATGGATGGAGAGTCTTC 3' ||||||||||||||||||||||||| 3' GGGAGTTTTACCTACCTCTCAGAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:81597090..81597114 25/25 Antisense target tbpl2.L
Scaffold70:233102..233126 21/25 Antisense off-target col27a1.L
tropicalis 10.0 Chr8:104568269..104568293 24/25 Antisense target tbpl2
Publications
First: Concentrations of TATA box-binding protein (TBP)-type genes affect chordamesodermal gene expression., Int J Dev Biol 2008      
Most recent:
View All Papers