Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250446

Morpholino Name: tbpl2 MO2
Synonyms: TBP-AS
mRNA Target: tbpl2

Morpholino Type: uncategorized morpholino
Sequence:
5' CAAAGAAGACTCTCCATCCATTTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CAAAATGGATGGAGAGTCTTCTTTG 3' ||||||||||||||||||||||||| 3' GTTTTACCTACCTCTCAGAAGAAAC 5' 5' CAAAATGGATGGAGAGTCTTCTTTG 3' ||||||||||||||||||||||||| 3' GTTTTACCTACCTCTCAGAAGAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold91950:911564..911588 25/25 Antisense target tbpl2.L
Scaffold107347:1550065..1550089 21/25 unknown
Scaffold3881:58321..58345 21/25 Sense off-target Xelaev16049568m
tropicalis 7.1 scaffold_8:83520131..83520155 25/25 Antisense target tbpl2
Publications
First: Specialized and redundant roles of TBP and a vertebrate-specific TBP paralog in embryonic gene regulation in Xenopus., Proc Natl Acad Sci U S A 2004  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556