Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250447

Morpholino Name: tbx1 MO1
Synonyms: Tbx1 #1
mRNA Target: tbx1

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGAAAACAAAGGGTTAATGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/22 22/22 22/22
genomic

MO
5' CACATTAACCCTTTGTTTTCTC 3' |||||||||||||||||||||| 3' GTGTAATTGGGAAACAAAAGAG 5' 5' CACATTAACCCTTTGTTTTCTC 3' |||||||||||||||||||||| 3' GTGTAATTGGGAAACAAAAGAG 5' 5' CACATTAACCCTTTGTTTTCTC 3' |||||||||||||||||||||| 3' GTGTAATTGGGAAACAAAAGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold42960:441316..441337 22/22 Antisense target tbx1.L
Scaffold97703:1594905..1594926 22/22 Antisense target tbx1.S
Scaffold149581:327832..327853 20/22 unknown
Scaffold183929:1602970..1602991 20/22 unknown
Scaffold40963:243469..243490 20/22 unknown
Scaffold5895:1447598..1447619 20/22 Antisense off-target slc20a2.L
Scaffold939:6198960..6198981 20/22 Sense off-target fam83g.L
Scaffold128184:363933..363954 19/22 Antisense off-target Xelaev16007951m
Scaffold13471:5550977..5550998 19/22 Antisense off-target slc17a9.L
Scaffold14692:538268..538289 19/22 unknown
Scaffold18892:2911304..2911325 19/22 unknown
Scaffold195582:112444..112465 19/22 Sense off-target Xelaev16024703m
Scaffold195950:850200..850221 19/22 unknown
Scaffold203041:6655054..6655075 19/22 unknown
Scaffold20641:4468761..4468782 19/22 unknown
Scaffold224593:6..27 19/22 unknown
Scaffold229341:811934..811955 19/22 Sense off-target Xelaev16029713m
Scaffold23301:5869106..5869127 19/22 unknown
Scaffold24467:4471166..4471187 19/22 unknown
Scaffold25254:1558871..1558892 19/22 unknown
Scaffold298574:1279589..1279610 19/22 unknown
Scaffold310750:243012..243033 19/22 Sense off-target Xelaev16041825m
Scaffold36295:621174..621195 19/22 Antisense off-target Xelaev16047201m
Scaffold36364:1895154..1895175 19/22 Antisense off-target Xelaev16047313m
Scaffold39454:1479..1500 19/22 unknown
Scaffold397445:354..375 19/22 unknown
Scaffold4754:2105872..2105893 19/22 unknown
Scaffold48114:2717997..2718018 19/22 Antisense off-target Xelaev16057507m
Scaffold52573:3123005..3123026 19/22 Antisense off-target Xelaev16060358m
Scaffold7045:1155361..1155382 19/22 Sense off-target dusp5.S
Scaffold78978:1640519..1640540 19/22 Antisense off-target Xelaev16073551m
Scaffold102262:71826..71847 18/22 Antisense off-target Xelaev16000364m
Scaffold1168:4697802..4697823 18/22 unknown
Scaffold133244:1133504..1133525 18/22 unknown
Scaffold15893:4052426..4052447 18/22 Antisense off-target Xelaev16016806m
Scaffold167390:331652..331673 18/22 Antisense off-target Xelaev16019135m
Scaffold16807:12275908..12275929 18/22 unknown
Scaffold17127:152117..152138 18/22 unknown
Scaffold19169:2178569..2178590 18/22 unknown
Scaffold2049:1933971..1933992 18/22 Antisense off-target Xelaev16026405m
Scaffold207208:2308447..2308468 18/22 unknown
Scaffold24235:661646..661667 18/22 Antisense off-target Xelaev16031984m
Scaffold277614:1445907..1445928 18/22 unknown
Scaffold29869:631004..631025 18/22 Sense off-target Xelaev16040132m
Scaffold3467:5272018..5272039 18/22 unknown
Scaffold3490:781073..781094 18/22 unknown
Scaffold41523:8095960..8095981 18/22 unknown
Scaffold47509:295476..295497 18/22 Sense off-target rbpj.S
Scaffold51966:261842..261863 18/22 unknown
Scaffold52702:2527202..2527223 18/22 Sense off-target Xelaev16060716m
Scaffold54899:92147..92168 18/22 unknown
Scaffold60518:1680022..1680043 18/22 Antisense off-target Xelaev16065567m
Scaffold7546:4107473..4107494 18/22 unknown
Scaffold86352:11291..11312 18/22 unknown
Scaffold93416:6574004..6574025 18/22 unknown
Scaffold97607:478309..478330 18/22 unknown
tropicalis 7.1 scaffold_1:53282264..53282285 22/22 Antisense target tbx1
scaffold_1:198450488..198450509 20/22 Antisense off-target add1
scaffold_183:116201..116222 20/22 unknown
scaffold_183:118245..118266 20/22 unknown
scaffold_988:5427..5448 20/22 unknown
scaffold_1:132950143..132950164 19/22 unknown
scaffold_1:43070981..43071002 19/22 unknown
scaffold_10:37619026..37619047 19/22 unknown
scaffold_10:37632728..37632749 19/22 unknown
scaffold_10:37647558..37647579 19/22 unknown
scaffold_10:5694559..5694580 19/22 Antisense off-target mtss1.2
scaffold_2:141166208..141166229 19/22 Antisense off-target c2cd3
scaffold_2012:11491..11512 19/22 unknown
scaffold_29:550657..550678 19/22 unknown
scaffold_3:100013653..100013674 19/22 unknown
scaffold_3:31675767..31675788 19/22 unknown
scaffold_4:114113051..114113072 19/22 Antisense off-target phkb
scaffold_5:115165579..115165600 19/22 Antisense off-target gpatch2
scaffold_5:13520932..13520953 19/22 unknown
scaffold_5:96725027..96725048 19/22 unknown
scaffold_507:5881..5902 19/22 unknown
scaffold_6:126477692..126477713 19/22 Sense off-target unnamed
scaffold_7:52948709..52948730 19/22 unknown
scaffold_8:58616277..58616298 19/22 unknown
scaffold_9:98980440..98980461 19/22 unknown
scaffold_1:210280825..210280846 18/22 unknown
scaffold_1:80066135..80066156 18/22 unknown
scaffold_132:29154..29175 18/22 unknown
scaffold_142:32104..32125 18/22 unknown
scaffold_2:119883069..119883090 18/22 unknown
scaffold_2:15987226..15987247 18/22 Antisense off-target bcas3
scaffold_2:31200666..31200687 18/22 unknown
scaffold_2:51805211..51805232 18/22 Antisense off-target stx1a
scaffold_2:64001053..64001074 18/22 unknown
scaffold_3:107600426..107600447 18/22 Antisense off-target sema3c
scaffold_3:33454776..33454797 18/22 unknown
scaffold_3:89743202..89743223 18/22 unknown
scaffold_3b:2358451..2358472 18/22 unknown
scaffold_4:14826894..14826915 18/22 unknown
scaffold_4:19776097..19776118 18/22 Antisense off-target ccdc34
scaffold_4:28201129..28201150 18/22 unknown
scaffold_5:86621346..86621367 18/22 unknown
scaffold_6:140943612..140943633 18/22 unknown
scaffold_6:142415603..142415624 18/22 unknown
scaffold_6:37115203..37115224 18/22 unknown
scaffold_7:34253493..34253514 18/22 unknown
scaffold_74:211454..211475 18/22 unknown
scaffold_75:77777..77798 18/22 unknown
scaffold_8:4246693..4246714 18/22 Antisense off-target abo
scaffold_83:215889..215910 18/22 unknown
scaffold_9:2367000..2367021 18/22 unknown
scaffold_9:2373127..2373148 18/22 unknown
scaffold_94:170464..170485 18/22 unknown
Publications
First: RIPPLY3 is a retinoic acid-inducible repressor required for setting the borders of the pre-placodal ectoderm., Development 2012                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556