Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250448

Morpholino Name: tbx1 MO2
Synonyms: Tbx2 #2
mRNA Target: tbx1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGCTGTTTCACTCTGTCCGTGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' CCCACGGACAGAGTGGAGCAGCAG 3' ||||||||||||||| | |||||| 3' GGGTGCCTGTCTCACTTTGTCGTC 5' 5' CCCACGGACAGAGTGAAACAGCAG 3' |||||||||||||||||||||||| 3' GGGTGCCTGTCTCACTTTGTCGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold97703:1594878..1594901 24/24 Antisense target tbx1.S
Scaffold181837:806086..806109 22/24 Sense off-target Xelaev16022103m
Scaffold42960:441289..441312 22/24 Antisense target tbx1.L
Scaffold81941:3342910..3342933 21/24 Antisense off-target Xelaev16075036m
Scaffold19985:776960..776983 20/24 Antisense off-target bag1.L
Scaffold7000:1176446..1176469 20/24 unknown
tropicalis 7.1 scaffold_5:109854392..109854415 22/24 unknown
scaffold_1:41404784..41404807 20/24 Sense off-target trim36
Publications
First: RIPPLY3 is a retinoic acid-inducible repressor required for setting the borders of the pre-placodal ectoderm., Development 2012                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556