Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250449

Morpholino Name: tbx1 MO3
Synonyms: Tbx1 MO
mRNA Target: tbx1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCGAGATCATCCCAGGAATAGACAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' CTGTCTATTCCTGGGATGATCTCGG 3' ||||||||||||||||||||||||| 3' GACAGATAAGGACCCTACTAGAGCC 5' 5' CTGTATATTCCTGGGATGATCTCGG 3' |||| |||||||||||||||||||| 3' GACAGATAAGGACCCTACTAGAGCC 5' 5' CTGTCTATTCCTGGGATGATCTCGG 3' ||||||||||||||||||||||||| 3' GACAGATAAGGACCCTACTAGAGCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7000:1176500..1176524 25/25 unknown
Scaffold97703:1594938..1594962 25/25 Antisense target tbx1.S
Scaffold42960:441349..441373 24/25 Antisense target tbx1.L
Scaffold3467:5960934..5960958 22/25 Antisense off-target Xelaev16045639m
tropicalis 7.1 scaffold_1:53282229..53282253 25/25 Antisense target tbx1
Publications
First: ARVCF depletion cooperates with Tbx1 deficiency in the development of 22q11.2DS-like phenotypes in Xenopus., Dev Dyn 2011                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556