Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250450

Morpholino Name: tbx1 MO4
Synonyms: Tbx1 exint-MO
mRNA Target: tbx1

Morpholino Type: uncategorized morpholino
Sequence:
5' CAAAAGATGGCCCTTACCTGCCAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' GCTGGCAGGTAAGCACCATATTTTG 3' ||||||||||||| |||| ||||| 3' CGACCGTCCATTCCCGGTAGAAAAC 5' 5' GCTGGCAGGTAAGGGCCATCTTTTG 3' ||||||||||||||||||||||||| 3' CGACCGTCCATTCCCGGTAGAAAAC 5' 5' GCTGGCAGGTAAGCGCCAACTTTTG 3' ||||||||||||| |||| |||||| 3' CGACCGTCCATTCCCGGTAGAAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold42960:441766..441790 25/25 Antisense target tbx1.L
Scaffold97703:1595355..1595379 23/25 Antisense target tbx1.S
Scaffold150991:519293..519317 22/25 unknown
tropicalis 7.1 scaffold_1:53281812..53281836 22/25 Antisense target tbx1
Publications
First: Paraxial T-box genes, Tbx6 and Tbx1, are required for cranial chondrogenesis and myogenesis., Dev Biol 2010                                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556