Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250451

Morpholino Name: tbx2 MO1
Synonyms: tbx2
mRNA Target: tbx2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTGCATACACAAATCCAGCAGGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 24/25 25/25
genomic

MO
5' TCTCCCCTGGATTTGTGCATGCACC 3' || | ||||||||||| ||||||| 3' AGGGACGACCTAAACACATACGTGG 5' 5' TCCCTCCTGGATTTGTGTATGCACC 3' ||||| ||||||||||||||||||| 3' AGGGACGACCTAAACACATACGTGG 5' 5' TCCCTGCTGGATTTGTGTATGCACC 3' ||||||||||||||||||||||||| 3' AGGGACGACCTAAACACATACGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold47398:1194976..1195000 25/25 Antisense target tbx2.S
Scaffold137317:722426..722450 24/25 Antisense target tbx2.L
Scaffold99286:1870221..1870245 21/25 Sense off-target Xelaev16081035m
tropicalis 7.1 scaffold_19:45578..45602 21/25 unknown
scaffold_2:15541971..15541995 21/25 Antisense target tbx2
scaffold_8:87208440..87208464 21/25 Antisense off-target ralgapa1
Publications
First: Transient expression of Ngn3 in Xenopus endoderm promotes early and ectopic development of pancreatic beta and delta cells., Genesis 2012                          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556