Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250452

Morpholino Name: tbx2 MO2
Synonyms: tbx2 mo
mRNA Target: tbx2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGAAAGCTGGATCTCTCATCGGTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCACCGATGAGAGATCCAGCTTTCC 3' ||||||||||||||||||||||||| 3' CGTGGCTACTCTCTAGGTCGAAAGG 5' 5' GCACCGATGAGAGATCCAGCTTTCC 3' ||||||||||||||||||||||||| 3' CGTGGCTACTCTCTAGGTCGAAAGG 5' 5' GCACCGATGAGAGATCCAGCTTTCC 3' ||||||||||||||||||||||||| 3' CGTGGCTACTCTCTAGGTCGAAAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold137317:722446..722470 25/25 Antisense target tbx2.L
Scaffold47398:1194956..1194980 25/25 Antisense target tbx2.S
tropicalis 7.1 scaffold_2:15541951..15541975 25/25 Antisense target tbx2
Publications
First: Role of Tbx2 in defining the territory of the pronephric nephron., Development 2011                          
Most recent: Tbx2 regulates anterior neural specification by repressing FGF signaling pathway., Dev Biol 2017                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556