Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250453

Morpholino Name: tbx20 MO1
Synonyms: Tbx20-MO1
Target mRNA: tbx20

Morpholino Type: uncategorized morpholino
Sequence: 5' AATCCACTTCCAAGGGCAGTTGCTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' AAGCATCAGCCCATGGAAGTGGATC 3' ||||| | |||| ||||||||||| 3' TTCGTTGACGGGAACCTTCACCTAA 5' 5' AAGCAACTGCCCTTGGAAGTGGATT 3' ||||||||||||||||||||||||| 3' TTCGTTGACGGGAACCTTCACCTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:63049639..63049663 25/25 Antisense target tbx20.L
chr5S:19760014..19760038 21/25 unknown
tropicalis 10.0 Chr6:64446285..64446309 21/25 Antisense target tbx20
Chr7:122358155..122358179 21/25 Sense off-target LOC116412195
Chr8:131023480..131023504 21/25 unknown
Publications
First: Tbx5 and Tbx20 act synergistically to control vertebrate heart morphogenesis., Development 2005                  
Most recent: DM-GRASP/ALCAM/CD166 is required for cardiac morphogenesis and maintenance of cardiac identity in first heart field derived cells., Dev Biol 2008              
View All Papers