Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250454

Morpholino Name: tbx20 MO2
Synonyms: Tbx20-MO2, tbx 20 MO2
Target mRNA: tbx20

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTTGGGAGAAGGAGTGTATTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGGAATACACACCCTCTCCCAAAC 3' ||||||||||| || |||||||||| 3' TACCTTATGTGAGGAAGAGGGTTTG 5' 5' ATGGAATACACTCCTTCTCCCAAAC 3' ||||||||||||||||||||||||| 3' TACCTTATGTGAGGAAGAGGGTTTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:63049807..63049831 25/25 Antisense target tbx20.L
chr2L:155208898..155208922 21/25 Sense off-target dclk1.L
chr2S:24751135..24751159 21/25 unknown
tropicalis 10.0 Chr6:64446456..64446480 23/25 Antisense target tbx20
Chr2:74799623..74799647 21/25 Antisense off-target synrg
Chr2:74799623..74799647 21/25 Sense off-target dynll2
Chr7:120672259..120672283 21/25 Antisense off-target LOC108648060
Chr1:121126231..121126255 21/25 unknown
Chr3:130817768..130817792 21/25 unknown
Publications
First: Tbx5 and Tbx20 act synergistically to control vertebrate heart morphogenesis., Development 2005                  
Most recent: DM-GRASP/ALCAM/CD166 is required for cardiac morphogenesis and maintenance of cardiac identity in first heart field derived cells., Dev Biol 2008              
View All Papers