Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250457

Morpholino Name: tbx6 MO1
Synonyms: Tbx6 exint-MO, Xtbx6 (exint MO), Xtbx6 exint MO
mRNA Target: tbx6

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCCCCAGTCACATACCTGAGTATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold184480:619..643 25/25 unknown
Scaffold144984:644..668 24/25 unknown
Scaffold248633:1451049..1451073 21/25 unknown
Publications
First: PMesogenin1 and 2 function directly downstream of Xtbx6 in Xenopus somitogenesis and myogenesis., Dev Dyn 2008          
Most recent: Paraxial T-box genes, Tbx6 and Tbx1, are required for cranial chondrogenesis and myogenesis., Dev Biol 2010                                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556