Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250469

Morpholino Name: tcf21 MO2
Synonyms: Pod-1 MO
mRNA Target: tcf21

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGTGGACATGATCTGTTATGCTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GCAGCATAACAGATCATGTCCACCG 3' ||||||||||||||||||||||||| 3' CGTCGTATTGTCTAGTACAGGTGGC 5' 5' GCAGCATAACAGATCATGTCCACCG 3' ||||||||||||||||||||||||| 3' CGTCGTATTGTCTAGTACAGGTGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6529:511883..511907 25/25 Antisense target tcf21.L
Scaffold29306:20868..20892 24/25 Antisense off-target Xelaev16039321m
tropicalis 7.1 scaffold_5:55950769..55950793 25/25 Antisense target tcf21
Publications
First: Normal levels of p27 are necessary for somite segmentation and determining pronephric organ size., Organogenesis 2009  
Most recent: Normal levels of p27 are necessary for somite segmentation and determining pronephric organ size., Organogenesis 2009                                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556