Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250470

Morpholino Name: tcf3 MO1
Synonyms: e2a MO
mRNA Target: tcf3

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTCATCCTCTGCTGTTGATTCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AATGAATCAACAGCAGAGGATGACA 3' ||||||||||||||||||||||||| 3' TTACTTAGTTGTCGTCTCCTACTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39437:3525749..3525773 24/25 Antisense off-target Xelaev16050122m
Scaffold54274:822720..822744 23/25 Antisense off-target Xelaev16061742m
Scaffold373158:1983944..1983968 21/25 Sense off-target Xelaev16048436m
Scaffold58784:429692..429716 21/25 unknown
tropicalis 7.1 scaffold_1:129637986..129638010 25/25 Antisense target tcf3
scaffold_2:53806385..53806409 21/25 unknown
scaffold_6:6860885..6860909 21/25 unknown
Publications
First: HEB and E2A function as SMAD/FOXH1 cofactors., Genes Dev 2011              
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556