Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250471

Morpholino Name: tcf7 MO1
Synonyms: Tcf1 MO, XTcf-1, XTcf-1 specific morpholino, Xtcf-1 MO, tcf1
mRNA Target: tcf7

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGCGCTGTTCATTTGGGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold17836:1465457..1465478 22/22 Antisense off-target Xelaev16021532m
Scaffold168805:275758..275779 19/22 Antisense off-target Xelaev16019978m
Scaffold14978:6853517..6853538 18/22 unknown
tropicalis 7.1 scaffold_3:51589315..51589336 22/22 unknown
scaffold_1:190751797..190751818 20/22 unknown
scaffold_6:8994193..8994214 19/22 Sense off-target zhx1
scaffold_7:56876712..56876733 19/22 unknown
scaffold_1:1350748..1350769 18/22 unknown
Publications
First: Distinct roles for Xenopus Tcf/Lef genes in mediating specific responses to Wnt/beta-catenin signalling in mesoderm development., Development 2005            
Most recent: The Wnt signaling mediator tcf1 is required for expression of foxd3 during Xenopus gastrulation., Int J Dev Biol 2013      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556