Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250471

Morpholino Name: tcf7 MO1
Synonyms: Tcf1 MO, XTcf-1, XTcf-1 specific morpholino, Xtcf-1 MO, tcf1
Target mRNA: tcf7

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGCGCTGTTCATTTGGGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/22 22/22
genomic

MO
5' ATGCCCCAAATGAACAGCGCCG 3' |||||||||||||||||||||| 3' TACGGGGTTTACTTGTCGCGGC 5' 5' ATGCCCCAAATGAACAGCGCCG 3' |||||||||||||||||||||| 3' TACGGGGTTTACTTGTCGCGGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:12704270..12704291 22/22 Antisense target tcf7.S
chr5S:89509565..89509586 19/22 Antisense off-target pex5l.S
chr2L:133727522..133727543 18/22 Sense off-target enox1.L
tropicalis 10.0 Chr3:26675791..26675812 22/22 Antisense target tcf7
Chr6:139787917..139787938 19/22 Sense off-target zhx1
Chr1:27658718..27658739 20/22 unknown
Chr7:69571063..69571084 19/22 unknown
Chr1:212249178..212249199 18/22 unknown
Publications
First: Distinct roles for Xenopus Tcf/Lef genes in mediating specific responses to Wnt/beta-catenin signalling in mesoderm development., Development 2005            
Most recent: The Wnt signaling mediator tcf1 is required for expression of foxd3 during Xenopus gastrulation., Int J Dev Biol 2013      
View All Papers