Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250472

Morpholino Name: tcf7l1 MO1
Synonyms: TCF3MO
Target mRNA: tcf7l1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGAGGCATGATGAGACTCCTCCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 24/24 24/24
genomic

MO
5' GCGGAGGAGTCGCACCATGCCTCA 3' ||||||||||| || ||||||||| 3' CGCCTCCTCAGAGTAGTACGGAGT 5' 5' GCGGAGGAGTCTCATCATGCCTCA 3' |||||||||||||||||||||||| 3' CGCCTCCTCAGAGTAGTACGGAGT 5' 5' GCGGAGGAGTCTCATCATGCCTCA 3' |||||||||||||||||||||||| 3' CGCCTCCTCAGAGTAGTACGGAGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:119434805..119434828 24/24 Antisense target tcf7l1.L
chr3S:25299279..25299302 24/24 Antisense target tcf7l1.S
tropicalis 10.0 Chr3:126768432..126768455 22/24 Antisense target tcf7l1
Chr1:130048190..130048213 20/24 Sense off-target trpm3
Publications
First: Regulation of TCF3 by Wnt-dependent phosphorylation during vertebrate axis specification., Dev Cell 2010          
Most recent: Rspo2 inhibits TCF3 phosphorylation to antagonize Wnt signaling during vertebrate anteroposterior axis specification., Sci Rep 2021              
View All Papers