Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250473

Morpholino Name: tcf7l1 MO2
Synonyms: Tcf3 MO, Tcf3-MO, tcf3
mRNA Target: tcf7l1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCCGCTGTTTAGTTGAGGCATGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' CCATGCCTCAGCTAAACAGCGGCG 3' ||||||||| ||||||||||||| 3' AGTACGGAGTTGATTTGTCGCCGC 5' 5' TCATGCCTCAACTAAACAGCGGCG 3' |||||||||||||||||||||||| 3' AGTACGGAGTTGATTTGTCGCCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold51940:649052..649075 24/24 Antisense target tcf7l1.L
tropicalis 7.1 scaffold_3:10893773..10893796 22/24 Antisense target tcf7l1
Publications
First: Distinct roles for Xenopus Tcf/Lef genes in mediating specific responses to Wnt/beta-catenin signalling in mesoderm development., Development 2005            
Most recent: Tcf7l1 promotes transcription of Kruppel-likefactor 4 during Xenopus embryogenesis., J Biomed Res 2017          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556