Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250474

Morpholino Name: tcf7l1 MO3
Synonyms: XTcf-3, Xtcf-3 MO, xtcf3MO
Target mRNA: tcf7l1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCTGTTGAGCTGAGGCATGATGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 23/25 25/25
genomic

MO
5' CGCACCATGCCTCAGCTAAACAGCG 3' | || |||||||||||| ||||||| 3' GAGTAGTACGGAGTCGAGTTGTCGC 5' 5' CTCATCATGCCTCAACTAAACAGCG 3' |||||||||||||| || ||||||| 3' GAGTAGTACGGAGTCGAGTTGTCGC 5' 5' CTCATCATGCCTCAGCTCAACAGCG 3' ||||||||||||||||||||||||| 3' GAGTAGTACGGAGTCGAGTTGTCGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:25299289..25299313 25/25 Antisense target tcf7l1.S
chr3L:119434794..119434818 23/25 Antisense target tcf7l1.L
tropicalis 10.0 Chr3:126768421..126768445 22/25 Antisense target tcf7l1
Publications
First: Cold-inducible RNA binding protein (CIRP), a novel XTcf-3 specific target gene regulates neural development in Xenopus., BMC Dev Biol 2008                                  
Most recent: Subfunctionalization and neofunctionalization of vertebrate Lef/Tcf transcription factors., Dev Biol 2012                
View All Papers