Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250475

Morpholino Name: tcf7l1 MO4
Synonyms: tcf3
mRNA Target: tcf7l1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCGCTGTTGAGCTGAGGCATGATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 23/25 25/25
genomic

MO
5' CACCATGCCTCAGCTAAACAGCGGC 3' || |||||||||||| ||||||||| 3' GTAGTACGGAGTCGAGTTGTCGCCG 5' 5' CATCATGCCTCAACTAAACAGCGGC 3' |||||||||||| || ||||||||| 3' GTAGTACGGAGTCGAGTTGTCGCCG 5' 5' CATCATGCCTCAGCTCAACAGCGGC 3' ||||||||||||||||||||||||| 3' GTAGTACGGAGTCGAGTTGTCGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:25299291..25299315 25/25 Antisense target tcf7l1.S
chr3L:119434792..119434816 23/25 Antisense target tcf7l1.L
chr2L:14858140..14858164 21/25 Sense off-target scaf4.L
tropicalis 10.0 Chr3:126768419..126768443 23/25 Antisense target tcf7l1
Publications
First: Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling., Dev Cell 2004              
Most recent:
View All Papers