Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250475

Morpholino Name: tcf7l1 MO4
Synonyms: tcf3
mRNA Target: tcf7l1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCGCTGTTGAGCTGAGGCATGATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 23/25 25/25
genomic

MO
5' CACCATGCCTCAGCTAAACAGCGGC 3' || |||||||||||| ||||||||| 3' GTAGTACGGAGTCGAGTTGTCGCCG 5' 5' CATCATGCCTCAACTAAACAGCGGC 3' |||||||||||| || ||||||||| 3' GTAGTACGGAGTCGAGTTGTCGCCG 5' 5' CATCATGCCTCAGCTCAACAGCGGC 3' ||||||||||||||||||||||||| 3' GTAGTACGGAGTCGAGTTGTCGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold286644:837288..837312 25/25 Antisense target tcf7l1.S
Scaffold51940:649050..649074 23/25 Antisense target tcf7l1.L
Scaffold6590:6370601..6370625 21/25 Sense off-target Xelaev16067547m
tropicalis 7.1 scaffold_3:10893771..10893795 23/25 Antisense target tcf7l1
Publications
First: Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling., Dev Cell 2004              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556