Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250476

Morpholino Name: tcf7l2 MO1
Synonyms: Tcf4 MO, XTcf-4, XTcf-4 ( Tmo ), Xtcf-4 MO, tcf4
Target mRNA: tcf7l2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCCATTCAACTGCGGCATCTCTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GCAGAGATGCCGCAGTTGAACGGCG 3' |||||||||||||||||||| |||| 3' CGTCTCTACGGCGTCAACTTACCGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold101342:174..198 25/25 unknown
tropicalis 10.0 Chr7:3319979..3320003 24/25 Antisense target tcf7l2
Publications
First: Autoregulation of canonical Wnt signaling controls midbrain development., Dev Biol 2004            
Most recent: The vestibuloocular reflex of tadpoles (Xenopus laevis) after knock-down of the isthmus-related transcription factor XTcf-4., J Exp Biol 2013  
View All Papers