Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250476

Morpholino Name: tcf7l2 MO1
Synonyms: Tcf4 MO, XTcf-4, XTcf-4 ( Tmo ), Xtcf-4 MO, tcf4
mRNA Target: tcf7l2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCCATTCAACTGCGGCATCTCTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold377111:174..198 25/25 unknown
Scaffold258242:120..144 22/25 unknown
Scaffold75561:120..144 22/25 unknown
Publications
First: Autoregulation of canonical Wnt signaling controls midbrain development., Dev Biol 2004            
Most recent: The vestibuloocular reflex of tadpoles (Xenopus laevis) after knock-down of the isthmus-related transcription factor XTcf-4., J Exp Biol 2013  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556