Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250477

Morpholino Name: tcf7l2 MO2
Synonyms: XTcf7l2 ex1b-in5
mRNA Target: tcf7l2

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAAGGTTCCTGTACTCACCCAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' GCTGGGTGAGTACAGGAACCTTTT 3' |||||||||||||||||||||||| 3' CGACCCACTCATGTCCTTGGAAAA 5' 5' GCTGGGTGAGTACAGGAACCTTTT 3' |||||||||||||||||||||||| 3' CGACCCACTCATGTCCTTGGAAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold20641:3234193..3234216 24/24 Antisense target tcf7l2.L
Scaffold7045:1385787..1385810 24/24 unknown
Scaffold102974:16707305..16707328 20/24 Sense off-target Xelaev16000879m
Scaffold41523:7467916..7467939 20/24 Sense off-target tdrd6.L
tropicalis 7.1 scaffold_7:1414393..1414416 24/24 Antisense target tcf7l2
scaffold_26:563957..563980 20/24 unknown
Publications
First: A novel mechanism for the transcriptional regulation of Wnt signaling in development., Genes Dev 2011        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556