Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250478

Morpholino Name: tcf7l2 MO3
Synonyms: XTcf7l2 exon1b
mRNA Target: tcf7l2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGCTTATCGCTTGGTACCTCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' TATGGAGGTACCCAGCGATAAGAAG 3' ||||||||||| ||||||||| || 3' CTACCTCCATGGTTCGCTATTCGTC 5' 5' GATGGAGGTACCAAGCGATAAGCAG 3' ||||||||||||||||||||||||| 3' CTACCTCCATGGTTCGCTATTCGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold20641:3234104..3234128 25/25 Antisense target tcf7l2.L
tropicalis 7.1 scaffold_7:1414304..1414328 22/25 Antisense target tcf7l2
Publications
First: A novel mechanism for the transcriptional regulation of Wnt signaling in development., Genes Dev 2011        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556