Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250479

Morpholino Name: tdgf1 MO1
Synonyms: FRL-1MO, MO XCR1.2
mRNA Target: tdgf1.3

Morpholino Type: uncategorized morpholino
Sequence:
5' AAACTGCATTGTTTTCTGCAAAGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GCCTTTGCAGACAACAATGCAGCTT 3' ||||||||||| |||||||||| || 3' CGGAAACGTCTTTTGTTACGTCAAA 5' 5' GCCTTTGCAGAAAACAATGCAGTTT 3' ||||||||||||||||||||||||| 3' CGGAAACGTCTTTTGTTACGTCAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13576:2488446..2488470 25/25 Antisense target tdgf1.3.L
Scaffold81941:2225230..2225254 23/25 Antisense off-target Xelaev16074989m
Scaffold167347:247901..247925 21/25 unknown
Scaffold245044:3264959..3264983 21/25 unknown
Scaffold254613:1082043..1082067 21/25 Sense off-target Xelaev16034350m
Scaffold3881:2246696..2246720 21/25 unknown
Scaffold47683:1198316..1198340 21/25 unknown
Scaffold5732:5476803..5476827 21/25 unknown
Scaffold85591:2020498..2020522 21/25 unknown
tropicalis 7.1 scaffold_1:88386510..88386534 23/25 Antisense target tdgf1.3
scaffold_8:38599153..38599177 22/25 unknown
scaffold_3:25630025..25630049 21/25 unknown
scaffold_3:83617327..83617351 21/25 unknown
scaffold_4:131634356..131634380 21/25 unknown
scaffold_4:98143897..98143921 21/25 Sense off-target usp24
scaffold_6:68096638..68096662 21/25 unknown
scaffold_7:98734128..98734152 21/25 Sense off-target trim28
Publications
First: FRL-1, a member of the EGF-CFC family, is essential for neural differentiation in Xenopus early development., Development 2003  
Most recent: A novel Cripto-related protein reveals an essential role for EGF-CFCs in Nodal signalling in Xenopus embryos., Dev Biol 2006    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556