Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250481

Morpholino Name: tdgf1 MO3
Synonyms: MO XCR1.3
mRNA Target: tdgf1.3

Morpholino Type: uncategorized morpholino
Sequence:
5' ATTTAATGTGTCCTCAGCAAAAGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold32519:83907..83931 25/25 Antisense off-target Xelaev16043114m
Scaffold112411:1271026..1271050 21/25 unknown
Scaffold143068:583747..583771 21/25 Sense off-target Xelaev16012837m
Scaffold99286:5571723..5571747 21/25 Sense off-target Xelaev16081111m
tropicalis 7.1 scaffold_5:80584076..80584100 21/25 Antisense off-target grm1
Publications
First: A novel Cripto-related protein reveals an essential role for EGF-CFCs in Nodal signalling in Xenopus embryos., Dev Biol 2006    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556