Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250482

Morpholino Name: tdgf1 MO4
Synonyms: MO XCR1.1
mRNA Target: tdgf1.3

Morpholino Type: uncategorized morpholino
Sequence:
5' CAAGAAATCTTAAAAACTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold4321:5293613..5293634 20/22 unknown
Scaffold57559:1425701..1425722 20/22 unknown
Scaffold99185:1143469..1143490 20/22 unknown
Scaffold106323:1004616..1004637 19/22 unknown
Scaffold157205:178623..178644 19/22 Sense off-target Xelaev16016568m
Scaffold172068:2108288..2108309 19/22 Sense off-target Xelaev16020696m
Scaffold17836:462509..462530 19/22 unknown
Scaffold178713:187242..187263 19/22 Antisense off-target Xelaev16021566m
Scaffold181959:38916..38937 19/22 unknown
Scaffold203041:4889867..4889888 19/22 unknown
Scaffold23403:9399345..9399366 19/22 unknown
Scaffold250717:24..45 19/22 unknown
Scaffold253809:2175322..2175343 19/22 Antisense off-target Xelaev16034196m
Scaffold286644:172972..172993 19/22 unknown
Scaffold336528:834..855 19/22 unknown
Scaffold340948:5252..5273 19/22 unknown
Scaffold43483:1312468..1312489 19/22 Antisense off-target Xelaev16053758m
Scaffold45965:903432..903453 19/22 Antisense off-target Xelaev16055574m
Scaffold46631:3362204..3362225 19/22 Sense off-target fhod1.L
Scaffold52441:9754518..9754539 19/22 unknown
Scaffold58038:756543..756564 19/22 Sense off-target Xelaev16063541m
Scaffold7546:4411649..4411670 19/22 unknown
Scaffold99337:182724..182745 19/22 unknown
Scaffold149890:3901679..3901700 18/22 unknown
Scaffold2511:145311..145332 18/22 Sense off-target b4galt6.L
Scaffold43791:4199389..4199410 18/22 unknown
Scaffold45174:1060265..1060286 18/22 Antisense off-target agpat4.S
Scaffold46215:2064703..2064724 18/22 Sense off-target Xelaev16056030m
Scaffold47509:644676..644697 18/22 unknown
Scaffold5925:3232411..3232432 18/22 unknown
Scaffold59883:2695761..2695782 18/22 unknown
Scaffold92959:11146..11167 18/22 unknown
Scaffold94859:856646..856667 18/22 unknown
tropicalis 7.1 scaffold_1:155817845..155817866 19/22 Sense off-target lef1
scaffold_1:67830423..67830444 19/22 Sense off-target fam72a
scaffold_1:89124342..89124363 19/22 unknown
scaffold_4:64465066..64465087 19/22 Sense off-target ptbp2
scaffold_6:118564274..118564295 19/22 unknown
scaffold_6:21143023..21143044 19/22 unknown
scaffold_6:50265972..50265993 19/22 unknown
scaffold_8:25249498..25249519 19/22 unknown
scaffold_9:14046832..14046853 19/22 Sense off-target kcnh7
scaffold_1:120222195..120222216 18/22 unknown
scaffold_1:45426407..45426428 18/22 unknown
scaffold_10:20123582..20123603 18/22 unknown
scaffold_2:34769212..34769233 18/22 unknown
scaffold_3:624648..624669 18/22 Sense off-target efcab6
scaffold_33:828900..828921 18/22 unknown
scaffold_4:128325439..128325460 18/22 unknown
scaffold_4:55634620..55634641 18/22 unknown
scaffold_5:21660896..21660917 18/22 unknown
scaffold_5:80234035..80234056 18/22 Sense off-target slc22a2
scaffold_5:95487529..95487550 18/22 unknown
scaffold_7:79025362..79025383 18/22 unknown
Publications
First: A novel Cripto-related protein reveals an essential role for EGF-CFCs in Nodal signalling in Xenopus embryos., Dev Biol 2006    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556