Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250483

Morpholino Name: tdgf1p2 MO1
Synonyms: XCR2 MO
mRNA Target: tdgf1.2

Morpholino Type: uncategorized morpholino
Sequence:
5' TACACTCACTGTTAGTTCTTACCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' GAGGTAAGAACTAACAGTGAATTTG 3' |||||||||||||||||||| | | 3' CTCCATTCTTGATTGTCACTCACAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12020:15815473..15815497 25/25 unknown
Scaffold13576:2608027..2608051 25/25 unknown
Scaffold27313:121893..121917 21/25 Sense off-target Xelaev16037498m
Scaffold7045:131637..131661 21/25 unknown
Scaffold86871:2831320..2831344 21/25 unknown
tropicalis 7.1 scaffold_1:88277825..88277849 22/25 Antisense target tdgf1.2
scaffold_1:188061252..188061276 21/25 unknown
scaffold_1:188068320..188068344 21/25 unknown
scaffold_1:190272838..190272862 21/25 unknown
Publications
First: XCR2, one of three Xenopus EGF-CFC genes, has a distinct role in the regulation of left-right patterning., Development 2006                                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556