Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250491

Morpholino Name: tfap2a MO1
Synonyms: AP2alpha MO
mRNA Target: tfap2a

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCGATCCTGCCATTCCCCCATTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold90041:5957846..5957870 22/25 unknown
tropicalis 7.1 scaffold_8:45212842..45212866 21/25 Antisense off-target slc6a14.1
Publications
First: Induction of neural crest in Xenopus by transcription factor AP2alpha., Proc Natl Acad Sci U S A 2003          
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556