Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250492

Morpholino Name: tfap2e MO1
Synonyms: Tfap2eMO
mRNA Target: tfap2e

Morpholino Type: uncategorized morpholino
Sequence:
5' GGGCACGATCACAGAAGAAAAGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold396475:408540..408563 21/24 Antisense off-target Xelaev16050454m
Scaffold16863:4212182..4212205 20/24 unknown
Scaffold19169:291402..291425 20/24 Sense off-target elmo2.L
Scaffold390640:80..103 20/24 unknown
Publications
First: Transcription factor AP2 epsilon (Tfap2e) regulates neural crest specification in Xenopus., Dev Neurobiol 2014                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556