Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250494

Morpholino Name: tgfb1 MO1
Synonyms: TGF-beta5
mRNA Target: tgfb1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAGCAGCATCCACAGAACCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' ATGGAGGTTCTTTGGATGCTGCCGG 3' ||||||||||| |||||||||| || 3' TACCTCCAAGACACCTACGACGACC 5' 5' ATGGAGGTTCTGTGGATGCTGCTGG 3' ||||||||||||||||||||||||| 3' TACCTCCAAGACACCTACGACGACC 5' 5' ATGGAGGTTCTGTGGATGCTGCTGG 3' ||||||||||||||||||||||||| 3' TACCTCCAAGACACCTACGACGACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:57226238..57226262 25/25 Antisense target tgfb1.L
chr8S:82719123..82719147 25/25 Antisense target tgfb1.S
Scaffold74:708488..708512 21/25 Sense off-target LOC108705105
tropicalis 10.0 Chr8:79309088..79309112 23/25 Antisense target tgfb1
Publications
First: Xenopus neurula left-right asymmetry is respeficied by microinjecting TGF-beta5 protein., Int J Dev Biol 2003                    
Most recent:
View All Papers