Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250494

Morpholino Name: tgfb1 MO1
Synonyms: TGF-beta5
mRNA Target: tgfb1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAGCAGCATCCACAGAACCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGGAGGTTCTTTGGATGCTGCCGG 3' ||||||||||| |||||||||| || 3' TACCTCCAAGACACCTACGACGACC 5' 5' ATGGAGGTTCTGTGGATGCTGCTGG 3' ||||||||||||||||||||||||| 3' TACCTCCAAGACACCTACGACGACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39723:9359010..9359034 25/25 Antisense target tgfb1.L
Scaffold50079:2566154..2566178 25/25 Antisense off-target Xelaev16058171m
Scaffold117532:93983..94007 21/25 Sense off-target Xelaev16004662m
tropicalis 7.1 scaffold_8:65045220..65045244 23/25 Antisense target tgfb1
Publications
First: Xenopus neurula left-right asymmetry is respeficied by microinjecting TGF-beta5 protein., Int J Dev Biol 2003                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556