Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250500

Morpholino Name: tle4 MO1
Synonyms: Gro / Grg4 GroMO, GroMO
mRNA Target: tle4

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTACATCTTGCTCAAGTCTCGAAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATTCGAGACTTGAGCAAGATGTACC 3' ||||||||||||||||||||||||| 3' TAAGCTCTGAACTCGTTCTACATGG 5' 5' ATTCGAGACTTGAGCAAGATGTACC 3' ||||||||||||||||||||||||| 3' TAAGCTCTGAACTCGTTCTACATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold29017:1106394..1106418 25/25 Antisense off-target Xelaev16039258m
Scaffold86871:1045046..1045070 25/25 Antisense target tle4.S
Scaffold18892:8168739..8168763 21/25 unknown
Scaffold65815:24..48 21/25 unknown
tropicalis 7.1 scaffold_1:92021489..92021513 25/25 Antisense target tle4
Publications
First: Specific domains of FoxD4/5 activate and repress neural transcription factor genes to control the progression of immature neural ectoderm to differentiating neural plate., Dev Biol 2012                          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556