Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250501

Morpholino Name: tll1 MO1
Synonyms: Xlr MO
mRNA Target: tll1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGATGAGCCAAGAAGGCATGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGAACATGCCTTCTTGGCTCATCT 3' ||||||||||||||||||||||||| 3' TACTTGTACGGAAGAACCGAGTAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14660:874061..874085 25/25 Antisense target tll1.S
Scaffold47337:682345..682369 25/25 Antisense off-target Xelaev16056651m
Scaffold47683:3870425..3870449 21/25 unknown
tropicalis 7.1 scaffold_1:173397032..173397056 24/25 unknown
Publications
First: Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation., Cell 2008                    
Most recent: Generation of animal form by the Chordin/Tolloid/BMP gradient: 100¬†years after D''Arcy Thompson., Dev Growth Differ 2017              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556