Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250517

Morpholino Name: tnik MO1
Synonyms: XTNIK-MO2
mRNA Target: tnik

Morpholino Type: uncategorized morpholino
Sequence:
5' CCCCGTTCTTTCCACCTTGCGGCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAGCCGCAAGGTGGAAAGAACGGGG 3' ||||||||||||||||||||||||| 3' GTCGGCGTTCCACCTTTCTTGCCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:92456618..92456642 25/25 Antisense target tnik.S
chr5L:117390002..117390026 22/25 unknown
Scaffold7162:88..112 21/25 unknown
Publications
First: Traf2- and Nck-interacting kinase is essential for canonical Wnt signaling in Xenopus axis formation., J Biol Chem 2010  
Most recent:
View All Papers